Validation of Quantitative PCR-Taqman Probe Method for Detection of Residual NS0 Host Cell DNA
WU Gang1, FU Zhi-hao1, YANG Zhi-xing2, CUI Yong-fei1, ZHANG Rong-jian1, ZONG Wei-ying2, WANG Lan1*
1. Key Laboratory of the Ministry of Health for Research on Quality and Standardization of Biotech Products, National Institutes for Food and Drug Control, Beijing 100050, China;
2. Shanghai Institute of Biological Sciences, Chinese Academy of Sciences, Huzhou Nutrition and Health Industry Innovation Center, Huzhou 313000, China
OBJECTIVE To validate a PCR-Taqman probe method for detection of residual DNA of NS0 host cells. METHODS Multiple pairs of primers and probes were designed and synthesized for the NS0 genome repeat sequence, and the optimal primer probe combination was selected through experiments. Pretreatment kit (magnetic bead method) was used to enrich and purify the host cell DNA residue in the sample.According to the requirements of ICH and China Pharmacopoeia general principle No. 9101, validation of the detection method including linearity and range, accuracy,precision, specificity, quantitative limit and reference DNA calibration was carried out for self-developed residual CHO host cell DNA quantitation kit (PCR-Taqman probe).Using the intermediate product and drug substance of the monoclonal antibody process produced by NS0 cells, the test performance of the kit was verified, and five independent laboratories were organized to coordinate the calibration. RESULTS NS0 cell DNA detection (Taqman method) forward primer sequence was CCCCTTCAGCTCCTTGGGTA, reverse primer sequence was GCCTGGCAAATACAGAAGTGG, and probe sequence was FAM-AGGGCCCCCAATGGAGGAGCT-TAMRA. The standard curve of DNA was in the range of 3 fg·μL-1 to 300 pg·μL-1 with good linearity (r2＞0. 99). The deviation of the mean from the true value was less than 15% at six different concentrations. The quantitative limit was 3 fg·μL-1.The DNA calibration result of the internal reference sample was 30 μg·mL-1. Good precision (RSD≤30%) was obtained. The q-PCR method was specific for CHO DNA,which showed no responses to the DNA of E. coli, human genome DNA(kidney epithelium 293T cells), and CHO genome DNA(Chinese hamster ovary cells). In addition, the detection recovery rate was in the range of 70% to 130% with RSD less than 15% for the intermediate products and drug substance in the production process. The RSD of the five collaborative laboratories was less than 30%. CONCLUSION The self-developed residual NS0 host cell DNA quantitation kit (PCR-Taqman probe) has good specificity, sensitivity and accuracy,and can meet the requirements of host DNA residue detection.
YANG H, WEI Z, SCHENERMAN M. A statistical approach to determining criticality of residual host cell DNA[J]. Biopharm Stat,2015, 25(2):234-246.
[2]
Food and Drug Administration (FDA) . Points to Consider in the Manufacture and Testing of Monoclonal Antibody Products for Human Use, Food and Drug Administration, Center for BiologicsEvaluation and Research[EB/OL]. 1997, [2019-06-18]. https://www.fda.gov/media/76798/download.
[3]
World Health Organization (WHO). WHO Expert Committee on Biological Standardization. Highlights of the 46th meeting, October 1996 [J]. Wkly Epidemiol Rec, 1997, 72(20): 141-145.
[4]
DHARA V G, NAIK H M, MAJEWSKANI. Recombinant antibody production in CHO and NS0 cells: differences and similaritie[J]. Bio Drugs, 2018, 6(32):571-584.
[5]
Ch.P(2015).Vol Ⅲ(中国药典2015年版. 三部)[S]. 2015:363-365, General Principle 9101.
[6]
RIAHI F, DERAKHSHAN M, MOSAVAT A, et al. Evaluation of point mutation detection in Mycobacterium tuberculosis with isoniazid resistance using real-time PCR and TaqMan probe assay[J]. Appl Biochem Biotechnol, 2015,175(5):2447-2455.
[7]
CHANG J T, CHEN Y C, CHOU Y C, et al. Quantitative detection of residual porcine host cell DNA by real-time PCR[J]. Biologicals, 2014,42(2):74-78.
[8]
USP. In-process revision: general chapters〈509〉residual DNA testing.PF Online[S].2016.
[9]
ICH. Harmonized tripartite guideline: validation of analytical procedures: text and methodology Q2(R1) [S]. 2005: 11.
[10]
HUSSAIN M. A direct qPCR method for residual DNA quantification in monoclonalantibody drugs produced in CHO cells [J]. J Pharm Biomed Anal, 2015, 115:603-606.
[11]
SOMMERS C, ROSENZWEIG B, OUML, et al. Quantitation of residual host cell DNA in protaminesulfate drug product by qPCR [J]. Pharm Biomed Anal,2018,160(25):238-243.
2019, Vol. 54 
